Instructions to use GenerTeam/GENERator-eukaryote-1.2b-base with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use GenerTeam/GENERator-eukaryote-1.2b-base with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("text-generation", model="GenerTeam/GENERator-eukaryote-1.2b-base", trust_remote_code=True)# Load model directly from transformers import AutoTokenizer, AutoModelForCausalLM tokenizer = AutoTokenizer.from_pretrained("GenerTeam/GENERator-eukaryote-1.2b-base", trust_remote_code=True) model = AutoModelForCausalLM.from_pretrained("GenerTeam/GENERator-eukaryote-1.2b-base", trust_remote_code=True) - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use GenerTeam/GENERator-eukaryote-1.2b-base with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "GenerTeam/GENERator-eukaryote-1.2b-base" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "GenerTeam/GENERator-eukaryote-1.2b-base", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker
docker model run hf.co/GenerTeam/GENERator-eukaryote-1.2b-base
- SGLang
How to use GenerTeam/GENERator-eukaryote-1.2b-base with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "GenerTeam/GENERator-eukaryote-1.2b-base" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "GenerTeam/GENERator-eukaryote-1.2b-base", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "GenerTeam/GENERator-eukaryote-1.2b-base" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "GenerTeam/GENERator-eukaryote-1.2b-base", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }' - Docker Model Runner
How to use GenerTeam/GENERator-eukaryote-1.2b-base with Docker Model Runner:
docker model run hf.co/GenerTeam/GENERator-eukaryote-1.2b-base
GENERator-eukaryote-1.2b-base model
Important Notice
If you are using GENERator for sequence generation, please ensure that the length of each input sequence is a multiple of 6. This can be achieved by either:
- Padding the sequence on the left with
'A'(left padding); - Truncating the sequence from the left (left truncation).
This requirement arises because GENERator employs a 6-mer tokenizer. If the input sequence length is not a multiple of 6, the tokenizer will append an '<oov>' (out-of-vocabulary) token to the end of the token sequence. This can result in uninformative subsequent generations, such as repeated 'AAAAAA'.
We apologize for any inconvenience this may cause and recommend adhering to the above guidelines to ensure accurate and meaningful generation results.
Abouts
In this repository, we present GENERator, a generative genomic foundation model featuring a context length of 98k base pairs and 1.2B parameters, trained on an expansive dataset comprising 386 billion base pairs of eukaryotic DNA. Our evaluations demonstrate that the GENERator consistently achieves state-of-the-art performance across a wide spectrum of benchmarks, including Genomic Benchmarks, NT tasks, and our newly proposed Gener tasks.
Beyond benchmark performance, the GENERator adheres to the central dogma of molecular biology, accurately generating protein-coding DNA sequences that produce proteins structurally analogous to known families. Moreover, the GENERator showcases significant promise in sequence optimization, particularly in the design of enhancer sequences that regulate gene expression during various biological stages, highlighting its potential for a series of biologically significant tasks. Our findings position the GENERator as a vital resource for genomic research and biotechnological advancement.
For more technical details, please refer to our paper GENERator: A Long-Context Generative Genomic Foundation Model. The code and implementation details are available on Github: https://github.com/GenerTeam/GENERator.
How to use
Example 1: Sequence Generation
import torch
from transformers import AutoTokenizer, AutoModelForCausalLM
model = AutoModelForCausalLM.from_pretrained(
"GenerTeam/GENERator-eukaryote-1.2b-base",
attn_implementation="flash_attention_2",
trust_remote_code=True,
dtype=torch.bfloat16,
).cuda().eval()
tokenizer = AutoTokenizer.from_pretrained(
"GenerTeam/GENERator-eukaryote-1.2b-base",
trust_remote_code=True,
)
# Define input sequences.
sequences = [
"ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG",
"ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"
]
# Truncate each sequence to the nearest multiple of 6
processed_sequences = ["<s>" + seq[len(seq)%6:] for seq in sequences]
# Tokenize the sequences
inputs = tokenizer(
processed_sequences,
add_special_tokens=False,
return_tensors="pt",
padding=True,
padding_side="left",
).to("cuda")
# Generate the sequences
with torch.inference_mode():
outputs = model.generate(**inputs, max_new_tokens=32, do_sample=False)
# Decode the generated sequences
decoded_sequences = tokenizer.batch_decode(outputs, skip_special_tokens=True)
# Print the decoded sequences
print(decoded_sequences)
Example 2: Embedding Extraction
import torch
from transformers import AutoTokenizer, AutoModelForCausalLM
model = AutoModelForCausalLM.from_pretrained(
"GenerTeam/GENERator-eukaryote-1.2b-base",
attn_implementation="flash_attention_2",
trust_remote_code=True,
dtype=torch.bfloat16,
).cuda().eval()
tokenizer = AutoTokenizer.from_pretrained(
"GenerTeam/GENERator-eukaryote-1.2b-base",
trust_remote_code=True,
)
# Define input sequences.
sequences = [
"ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG",
"ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT"
]
# Truncate each sequence to the nearest multiple of 6
processed_sequences = ["<s>" + seq[len(seq)%6:] for seq in sequences]
# Tokenize the sequences
inputs = tokenizer(
processed_sequences,
add_special_tokens=False,
return_tensors="pt",
padding=True,
padding_side="right",
).to("cuda")
with torch.inference_mode():
outputs = model(**inputs, output_hidden_states=True)
hidden_states = outputs.hidden_states[-1]
attention_mask = inputs["attention_mask"]
# Option 1: Last token embedding
last_token_indices = attention_mask.sum(dim=1) - 1
last_token_embeddings = hidden_states[torch.arange(hidden_states.size(0)), last_token_indices, :]
# Option 2: Mean pooling over all tokens
expanded_mask = attention_mask.unsqueeze(-1).expand(hidden_states.size()).to(torch.float32)
sum_embeddings = torch.sum(hidden_states * expanded_mask, dim=1)
mean_embeddings = sum_embeddings / expanded_mask.sum(dim=1)
# Output
print("Last Token Embeddings:", last_token_embeddings)
print("Mean Pooling Embeddings:", mean_embeddings)
# ============================================================================
# The choice depends on your downstream task requirements
# - Last token embeddings capture more localized gene-level information (e.g., strand, codon phase).
# - Mean pooling embeddings capture species-level information.
# ============================================================================
Citation
@misc{wu2025generator,
title={GENERator: A Long-Context Generative Genomic Foundation Model},
author={Wei Wu and Qiuyi Li and Mingyang Li and Kun Fu and Fuli Feng and Jieping Ye and Hui Xiong and Zheng Wang},
year={2025},
eprint={2502.07272},
archivePrefix={arXiv},
primaryClass={cs.CL},
url={https://arxiv.org/abs/2502.07272},
}
- Downloads last month
- 627